Haplogroup R2
| Haplogroup R2 | |
|---|---|
 |
|
| Possible time of origin | 12,000 ybp |
| Possible place of origin | South Asia |
| Ancestor | Haplogroup R |
| Descendants | Haplogroup R2a |
| Defining mutations | M479 |
| Highest frequencies | South Asia |
Haplogroup R2, or haplogroup R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It has been concentrated geographically in South Asia since prehistoric times.
Contents
Subclades
| Haplogroup R2 |
|
||||||
Paragroup R-M479*
Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.
Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.
| Count | Sample size | R-M479* Frequency | |
|---|---|---|---|
| Portugal, Lisbon | 1 | 100 | 0.010 |
| Andalusia, Sevilla | 1 | 127 | 0.008 |
| Bashkirs (Bashkortostan, Russia) | 1 | 39 | 0.026 |
| Italy North | 1 | 124 | 0.008 |
| Ossetian South (South Caucasus) | 1 | 23 | 0.043 |
| Pakistan North | 6 | 85 | 0.071 |
Haplogroup R-M124
Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.
Haplogroup R2 is a subgroup of Haplogroup R (M207):
- R-M207 (M207)
Description of the M479 SNP
| Common Name Marker | M479 |
|---|---|
| YCC Haplogroup | R-M479 |
| Nucleotide change | C to T |
| Amplicon size (bp) reference sequence | 323 |
| Polymorphism position from 5' end | 107 |
| Restriction enzyme variant | HphI |
| RefSNP ID | - |
| Y-position | 19294055 |
| Primer forward 5'-3' | gatactttatcaggcttacttc |
| Primer reverse 5'-3' | aaccaaatctctcagaatcg |
Notes
<templatestyles src="Reflist/styles.css" />
Cite error: Invalid <references> tag; parameter "group" is allowed only.
<references />, or <references group="..." />See also
Y-DNA R-M207 subclades
<templatestyles src="Div col/styles.css"/>
Y-DNA backbone tree
| Evolutionary tree of human Y-chromosome DNA haplogroups [χ 1][χ 2] | |||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| "Y-chromosomal Adam" | |||||||||||||||||||||||||||||||||||||||||||||||||
| A00 | A0-T [χ 3] | ||||||||||||||||||||||||||||||||||||||||||||||||
| A0 | A1[χ 4] | ||||||||||||||||||||||||||||||||||||||||||||||||
| A1a | A1b | ||||||||||||||||||||||||||||||||||||||||||||||||
| A1b1 | BT | ||||||||||||||||||||||||||||||||||||||||||||||||
| B | CT | ||||||||||||||||||||||||||||||||||||||||||||||||
| DE | CF | ||||||||||||||||||||||||||||||||||||||||||||||||
| D | E | C | F | ||||||||||||||||||||||||||||||||||||||||||||||
| F1 | F2 | F3 | GHIJK | ||||||||||||||||||||||||||||||||||||||||||||||
| G | HIJK | ||||||||||||||||||||||||||||||||||||||||||||||||
| H | IJK | ||||||||||||||||||||||||||||||||||||||||||||||||
| IJ | K | ||||||||||||||||||||||||||||||||||||||||||||||||
| I | J | LT [χ 5] | K2 | ||||||||||||||||||||||||||||||||||||||||||||||
| L | T | NO [χ 6] | K2b [χ 7] | K2c | K2d | K2e [χ 8] | |||||||||||||||||||||||||||||||||||||||||||
| N | O | K2b1 [χ 9] | P | ||||||||||||||||||||||||||||||||||||||||||||||
| M | S [χ 10] | Q | R | ||||||||||||||||||||||||||||||||||||||||||||||
| <templatestyles src="Reflist/styles.css" />
Cite error: Invalid <references />, or <references group="..." /> |
|||||||||||||||||||||||||||||||||||||||||||||||||
External links
- The India Genealogical DNA Project
- R2 Y-Chromosome Haplogroup DNA Project
- Digging into Haplogroup R2 (Y-DNA)
- R2-M124-WTY (Walk Through the Y) Project
- List of R2 frequencyca:Haplogrup R2 del cromosoma Y humà
es:Haplogrupo R2 ADN-Y ru:Гаплогруппа R2 (Y-ДНК)
Cite error: <ref> tags exist for a group named "χ", but no corresponding <references group="χ"/> tag was found, or a closing </ref> is missing
